Knockout of SlDCL2b attenuates the resistance of tomato to potato spindle tuber viroid infection.

RNA interference, or RNA silencing, is an important defence mechanism against viroid infection in plants. Plants encode multiple DICER-LIKE (DCL) proteins that are key components of the RNA silencing pathway. However, the roles of different DCLs in defence responses against viroid infection remain unclear. Here, we determined the function of tomato DCL2b (SlDCL2b) in defence responses against potato spindle tuber viroid (PSTVd) infection using SlDCL2b loss-of-function tomato mutant plants. Compared with wild-type plants, mutant plants were more susceptible to PSTVd infection, developing more severe symptoms earlier and accumulating higher levels of PSTVd RNAs. Moreover, we verified the feedback mechanism for the regulation of SlDCL2b expression by miR6026. Functional blocking of tomato miR6026, by expressing its target mimics, can enhance resistance to PSTVd infection in tomato plants. These findings deepen the current understanding of RNAi-based resistance against viroid infection and provide a potentially new strategy for viroid control.

Conserved untranslated regions of multipartite viruses: Natural markers of novel viral genomic components and tags of viral evolution.

Viruses with split genomes are classified as being either segmented or multipartite based on whether their genomic segments occur within a single virion or across different virions. Despite variations in number and sequence during evolution, the genomic segments of many viruses are conserved within the untranslated regions (UTRs). In this study, we present a methodology that combines RNA sequencing with iterative BLASTn of UTRs (https://github.com/qq371260/Iterative-blast-v.1.0) to identify new viral genomic segments. Some novel multipartite-like viruses related to the phylum Kitrinoviricota were annotated using sequencing data from field plant samples and public databases. We identified potentially plant-infecting jingmen-related viruses (order Amarillovirales) and jivi-related viruses (order Martellivirales) with at least six genomic components. The number of RNA molecules associated with a genome of the novel viruses in the families Closteroviridae, Kitaviridae, and Virgaviridae within the order Martellivirales reached five. Several of these viruses seem to represent new taxa at the subgenus, genus, and family levels. The diversity of novel genomic components and the multiple duplication of proteins or protein domains within single or multiple genomic components emphasize the evolutionary roles of genetic recombination (horizontal gene transfer), reassortment, and deletion. The relatively conserved UTRs at the genome level might explain the relationships between monopartite and multipartite viruses, as well as how subviral agents such as defective RNAs and satellite viruses can coexist with their helper viruses.

Functional Evolution of Pseudofabraea citricarpa as an Adaptation to Temperature Change.

Citrus target spot, caused by Pseudofabraea citricarpa, was formerly considered a cold-tolerant fungal disease. However, it has now spread from high-latitude regions to warmer low-latitude regions. Here, we conducted physiological observations on two different strains of the fungus collected from distinct regions, and evaluated their pathogenicity. Interestingly, the CQWZ collected from a low-latitude orchard, exhibited higher temperature tolerance and pathogenicity when compared to the SXCG collected from a high-latitude orchard. To further understand the evolution of temperature tolerance and virulence in these pathogens during the spread process, as well as the mechanisms underlying these differences, we performed genomic comparative analysis. The genome size of CQWZ was determined to be 44,004,669 bp, while the genome size of SXCG was determined to be 45,377,339 bp. Through genomic collinearity analysis, we identified two breakpoints and rearrangements during the evolutionary process of these two strains. Moreover, gene annotation results revealed that the CQWZ possessed 376 annotated genes in the "Xenobiotics biodegradation and metabolism" pathway, which is 79 genes more than the SXCG. The main factor contributing to this difference was the presence of salicylate hydroxylase. We also observed variations in the oxidative stress pathways and core pathogenic genes. The CQWZ exhibited the presence of a heat shock protein (HSP SSB), a catalase (CAT2), and 13 core pathogenic genes, including a LysM effector, in comparison to the SXCG. Furthermore, there were significant disparities in the gene clusters responsible for the production of seven metabolites, such as Fumonisin and Brefeldin. Finally, we identified the regulatory relationship, with the HOG pathway at its core, that potentially contributes to the differences in thermotolerance and virulence. As the global climate continues to warm, crop pathogens are increasingly expanding to new territories. Our findings will enhance understanding of the evolution mechanisms of pathogens under climate change.

Effects of RNA silencing during antagonism between citrus exocortis viroid and citrus bark cracking viroid in Etrog citron (Citrus medica).

Citrus exocortis viroid (CEVd) and citrus bark cracking viroid (CBCVd) are two important viroids that infect citrus plants and frequently occur as mixed infections in orchards. However, the mechanism of antagonism between the two viroids in mixed infections remains unclear. The CEVd/CBCVd-citron system and small RNA sequencing (sRNA-seq) were used to study the antagonism. When CBCVd was inoculated before CEVd, the CEVd titre was significantly reduced and the symptoms were attenuated. Viroid-derived sRNAs (vd-sRNAs) from CEVd and CBCVd were predominantly 21-nucleotide (nt) and 22-nt in length and had similar 5' base biases. Homologous sequences of the two viroids in the terminal right (TR) region are rich in vd-sRNAs, and the high frequency vd-sRNAs selected from the CBCVd TR region can be used to degrade the transcripts of CEVd in vivo directly. These results suggest that RNA silencing may play an important role in the antagonism of the two viroids, thus deepening our understanding of the molecular interaction of long noncoding RNAs in woody plants.

Transcriptional plasticity of schizotrophic Sclerotinia sclerotiorum responds to symptomatic rapeseed and endophytic wheat hosts.

IMPORTANCE: The broad host range of fungi with differential fungal responses leads to either a pathogenic or an endophytic lifestyle in various host plants. Yet, the molecular basis of schizotrophic fungal responses to different plant hosts remains unexplored. Here, we observed a general increase in the gene expression of S. sclerotiorum associated with pathogenicity in symptomatic rapeseed, including small protein secretion, appressorial formation, and oxalic acid toxin production. Conversely, in wheat, many carbohydrate metabolism and transport-associated genes were induced, indicating a general increase in processes associated with carbohydrate acquisition. Appressorium is required for S. sclerotiorum during colonization in symptomatic hosts but not in endophytic wheat. These findings provide new clues for understanding schizotrophic fungi, fungal evolution, and the emergence pathways of new plant diseases.

Promoter characterization of a citrus linalool synthase gene mediating interspecific variation in resistance to a bacterial pathogen.

BACKGROUND: Terpenoids play essential roles in plant defense against biotic stresses. In Citrus species, the monoterpene linalool mediates resistance against citrus canker disease caused by the gram-negative bacteria Xanthomonas citri subsp. citri (Xcc). Previous work had associated linalool contents with resistance; here we characterize transcriptional responses of linalool synthase genes. RESULTS: Leaf linalool contents are highly variable among different Citrus species. "Dongfang" tangerine (Citrus reticulata), a species with high linalool levels was more resistant to Xcc than "Shatian" pummelo (C. grandis) which accumulates only small amounts of linalool. The coding sequences of the major leaf-expressed linalool synthase gene (STS4) are highly conserved, while transcript levels differ between the two Citrus species. To understand this apparent differential transcription, we isolated the promoters of STS4 from the two species, fused them to a GUS reporter and expressed them in Arabidopsis. This reporter system revealed that the two promoters have different constitutive activities, mainly in trichomes. Interestingly, both linalool contents and STS4 transcript levels are insensitive to Xcc infestation in citrus plants, but in these transgenic Arabidopsis plants, the promoters are activated by challenge of a bacterial pathogen Pseudomonas syringae, as well as wounding and external jasmonic acid treatment. CONCLUSIONS: Our study reveals variation in linalool and resistance to Xcc in citrus plants, which may be mediated by different promoter activities of a terpene synthase gene in different Citrus species.

A Sec-dependent effector, CLIBASIA_04425, contributes to virulence in 'Candidatus Liberibater asiaticus'.

Citrus Huanglongbing (HLB) is the most destructive citrus disease worldwide, mainly caused by 'Candidatus Liberibacter asiaticus' (CLas). It encodes a large number of Sec-dependent effectors that contribute to HLB progression. In this study, an elicitor triggering ROS burst and cell death in Nicotiana benthamiana, CLIBASIA_04425 (CLas4425), was identified. Of particular interest, its cell death-inducing activity is associated with its subcellular localization and the cytoplasmic receptor Botrytis-induced kinase 1 (BIK1). Compared with CLas infected psyllids, CLas4425 showed higher expression level in planta. The transient expression of CLas4425 in N. benthamiana and its overexpression in Citrus sinensis enhanced plant susceptibility to Pseudomonas syringae pv. tomato DC3000 ΔhopQ1-1 and CLas, respectively. Furthermore, the salicylic acid (SA) level along with the expression of genes NPR1/EDS1/NDR1/PRs in SA signal transduction was repressed in CLas4425 transgenic citrus plants. Taken together, CLas4425 is a virulence factor that promotes CLas proliferation, likely by interfering with SA-mediated plant immunity. The results obtained facilitate our understanding of CLas pathogenesis.

Interaction between the flagellum of Candidatus Liberibacter asiaticus and the vitellogenin-like protein of Diaphorina citri significantly influences CLas titer.

Huanglongbing (HLB) is a global devastating citrus disease that is mainly caused by "Candidatus Liberibacter asiaticus" (CLas). It is mostly transmitted by the insect Asian citrus psyllid (ACP, Diaphorina citri) in a persistent and proliferative manner. CLas traverses multiple barriers to complete an infection cycle and is likely involved in multiple interactions with D. citri. However, the protein-protein interactions between CLas and D. citri are largely unknown. Here, we report on a vitellogenin-like protein (Vg_VWD) in D. citri that interacts with a CLas flagellum (flaA) protein. We found that Vg_VWD was upregulated in CLas-infected D. citri. Silencing of Vg_VWD in D. citri via RNAi silencing significantly increased the CLas titer, suggesting that Vg_VWD plays an important role in the CLas-D. citri interaction. Agrobacterium-mediated transient expression assays indicated that Vg_VWD inhibits BAX- and INF1-triggered necrosis and suppresses the callose deposition induced by flaA in Nicotiana benthamiana. These findings provide new insights into the molecular interaction between CLas and D. citri.

The interaction between the lemon ribosomal protein ClRPS9-2 and citrus yellow vein clearing virus coat protein affects viral infection and gene silencing suppressor activity.

Citrus yellow vein clearing virus (CYVCV) is an emerging virus that causes serious economic damage to the lemon industry worldwide. The coat protein (CP) of CYVCV is a strong RNA silencing suppressor and is associated with the severity of symptoms in citrus, yet the interaction between CP and host factors remains unknown. In this study, the 40S ribosomal subunit protein S9-2 (ClRPS9-2) was identified as a CP-binding partner using the yeast two-hybrid system from a lemon (cv. Eureka) cDNA library, and the interaction between CP and ClRPS9-2 was demonstrated by in vivo methods. The results suggest that the N-terminal 8-108 amino acid sequence of ClRPS9-2 is crucial for its interaction with CP and may be associated with the nuclear localization of ClRPS9-2. The accumulation and silencing suppressor activity of CP were reduced by transient expression of ClRPS9-2 in Nicotiana benthamiana. Reverse transcription-quantitative PCR analysis showed that the content of CYVCV in ClRPS9-2 transgenic Eureka lemon plants was approximately 50% of that in CYVCV-infected wild-type plants 1 month after inoculation, and mild yellowing and vein clearing symptoms were observed in the transgenic plants. These findings demonstrate that ClRPS9-2 plays a role in host defensive reactions, and the enhanced resistance of transgenic plants to CYVCV may be associated with the up-regulation of salicylic acid-related and R genes.

An effector of 'Candidatus Liberibacter asiaticus' manipulates autophagy to promote bacterial infection.

Autophagy functions in plant host immunity responses to pathogen infection. The molecular mechanisms and functions used by the citrus Huanglongbing (HLB)-associated intracellular bacterium 'Candidatus Liberibacter asiaticus' (CLas) to manipulate autophagy are unknown. We identified a CLas effector, SDE4405 (CLIBASIA_04405), which contributes to HLB progression. 'Wanjincheng' orange (Citrus sinensis) transgenic plants expressing SDE4405 promotes CLas proliferation and symptom expression via suppressing host immunity responses. SDE4405 interacts with the ATG8-family of proteins (ATG8s), and their interactions activate autophagy in Nicotiana benthamiana. The occurrence of autophagy is also significantly enhanced in SDE4405-transgenic citrus plants. Interrupting NbATG8s-SDE4405 interaction by silencing of NbATG8c reduces Pseudomonas syringae pv. tomato strain DC3000ΔhopQ1-1 (Pst DC3000ΔhopQ1-1) proliferation in N. benthamiana, and transient overexpression of CsATG8c and SDE4405 in citrus promotes Xanthomonas citri subsp. citri (Xcc) multiplication, suggesting that SDE4405-ATG8s interaction negatively regulates plant defense. These results demonstrate the role of the CLas effector protein in manipulating autophagy, and provide new molecular insights into the interaction between CLas and citrus hosts.

Roles of Brossinosteroids Signaling in Biotic and Abiotic Stresses.

Brassinosteroids (BRs) are a group of plant-specific steroidal phytohormones, which play fundamental roles in regulating diverse aspects of the plant life cycle including plant growth, development, and stress response. Extensive studies have demonstrated that BRs signaling is involved in plant innate immunity as well as the response to environmental stimuli including extreme temperatures, saline-alkali, and drought. In addition, that the BRs signal interacts with other immune-related signals, constructing a complex signal network to regulate plant-microbe interactions and adaptation to adverse environments, has also been preliminarily explored. A timely and updated review on these progresses is of great significance for understanding BRs functions, improving the BRs regulation network and breeding disease-resistant crops, meantime with higher tolerance to abiotic stresses. Here, we mainly focus on the latest advances in the BRs signal which regulate plant defense and tolerance to abiotic and biotic stresses and then further highlight the crosstalk between the BRs signal and other immune-related or stress response pathways, with an aim to use them to improve crops by transgenic technologies.

Regulation of Nicotiana benthamiana cell death induced by citrus chlorotic dwarf-associated virus-RepA protein by WRKY 1.

Citrus chlorotic dwarf-associated virus (CCDaV) is a Citlodavirus species in the Geminiviridae family that causes tremendous economic loss to the citrus industry in China. Some proteins encoded by geminiviruses are crucial for the interaction between the virus and its host plant. However, the exact functions of CCDaV-encoded proteins such as CCDaV-RepA have not been investigated. This study presents evidence that CCDaV-RepA elicits a hypersensitive response (HR)-like cell death in Nicotiana benthamiana that was accompanied by the production of H2O2 and ion leakage, which suggested that CCDaV-RepA is a potential recognition target for inducing host defense responses. Furthermore, the rolling-circle replication motifs of CCDaV-RepA are associated with triggering HR-like cell death in N. benthamiana. Confocal microscopy and deletion mutagenesis assays showed that CCDaV-RepA was located in the nucleus, while the first eight amino acids (aa) at the N terminus and two regions located between aa residues 122-263 and 220-264 of RepA were not associated with nuclear localization. Tobacco rattle virus-induced gene silencing of the key signaling cascade components revealed that HR-like cell death induced by RepA was inhibited in WRKY1-silenced N. benthamiana. Moreover, WRKY1 expression was upregulated in RepA-GFP infiltrated Overall, the results suggest that NbWRKY1 positively regulated CCDaV-RepA -induced cell death in N. benthamiana. These findings provide novel information for further research on the interactions between CCDaV and the host plant.

'Candidatus Liberibacter asiaticus' secretory protein SDE3 inhibits host autophagy to promote Huanglongbing disease in citrus.

Antimicrobial acroautophagy/autophagy plays a vital role in degrading intracellular pathogens or microbial molecules in host-microbe interactions. However, microbes evolved various mechanisms to hijack or modulate autophagy to escape elimination. Vector-transmitted phloem-limited bacteria, Candidatus Liberibacter (Ca. Liberibacter) species, cause Huanglongbing (HLB), one of the most catastrophic citrus diseases worldwide, yet contributions of autophagy to HLB disease proliferation remain poorly defined. Here, we report the identification of a virulence effector in "Ca. Liberibacter asiaticus" (Las), SDE3, which is highly conserved among the "Ca. Liberibacter". SDE3 expression not only promotes the disease development of HLB and canker in sweet orange (Citrus sinensis) plants but also facilitates Phytophthora and viral infections in Arabidopsis, and Nicotiana benthamiana (N. benthamiana). SDE3 directly associates with citrus cytosolic glyceraldehyde-3-phosphate dehydrogenases (CsGAPCs), which negatively regulates plant immunity. Overexpression of CsGAPCs and SDE3 significantly inhibits autophagy in citrus, Arabidopsis, and N. benthamiana. Intriguingly, SDE3 undermines autophagy-mediated immunity by the specific degradation of CsATG8 family proteins in a CsGAPC1-dependent manner. CsATG8 degradation is largely rescued by treatment with an inhibitor of the late autophagic pathway, E64d. Furthermore, ectopic expression of CsATG8s enhances Phytophthora resistance. Collectively, these results suggest that SDE3-CsGAPC interactions modulate CsATG8-mediated autophagy to enhance Las progression in citrus.Abbreviations: ACP: asian citrus psyllid; ACD2: ACCELERATED CELL DEATH 2; ATG: autophagy related; Ca. Liberibacter: Candidatus Liberibacter; CaMV: cauliflower mosaic virus; CMV: cucumber mosaic virus; Cs: Citrus sinensis; EV: empty vector; GAPC: cytosolic glyceraldehyde-3-phosphate dehydrogenase; HLB: huanglongbing; H2O2: hydrogen peroxide; Las: liberibacter asiaticus; Laf: liberibacter africanus; Lam: liberibacter americanus; Pst: Pseudomonas syringae pv. tomato; PVX: potato virus X; ROS: reactive oxygen species; SDE3: sec-delivered effector 3; TEM: transmission electron microscopy; VIVE : virus-induced virulence effector; WT: wild-type; Xcc: Xanthomonas citri subsp. citri.

Transcriptome analysis of Citrus limon infected with Citrus yellow vein clearing virus.

BACKGROUND: Citrus yellow vein clearing virus (CYVCV) is the causative agent of citrus yellow vein clearing disease, and poses a serious threat to the lemon industry in Asia. The common symptoms of CYVCV-infected lemon plants are leaf crinkling, leaf chlorotic mottling, and yellow vein clearing. However, the molecular mechanisms underlying CYVCV-citrus interaction that responsible for symptom occurrence is still unclarified. In this study, RNA-seq was performed to analyze the gene expression patterns of 'Eureka' lemon (Citrus limon Burm. f.) plants in response to CYVCV infection. RESULTS: There were 3691 differentially expressed genes (DEGs) identified by comparison between mock and CYVCV-infected lemon plants through RNA-seq. Bioinformatics analyses revealed that these DEGs were components of different pathways involved in phenylpropanoid biosynthesis, brassinosteroid biosynthesis, flavonoid biosynthesis and photosynthesis. Among these, the DEGs related to phytohormone metabolism and photosynthesis pathways were further enriched and analyzed. This study showed that different phytohormone-related genes had different responses toward CYVCV infection, however almost all of the photosynthesis-related DEGs were down-regulated in the CYVCV-infected lemon plants. The obtained RNA-seq data were validated by RT-qPCR using 12 randomly chosen genes, and the results of mRNA expression analysis were consistent with those of RNA-seq. CONCLUSIONS: The phytohormone biosynthesis, signaling and photosynthesis-related genes of lemon plants were probably involved in systemic infection and symptom occurrence of CYVCV. Notably, CYVCV infection had regulatory effects on the biosynthesis and signaling of phytohormone, which likely improve systemic infection of CYVCV. Additionally, CYVCV infection could cause structural changes in chloroplast and inhibition of photosynthesis pathway, which probably contribute to the appearance of leaf chlorotic mottling and yellow vein clearing in CYVCV-infected lemon plants. This study illustrates the dynamic nature of the citrus-CYVCV interaction at the transcriptome level and provides new insights into the molecular mechanism underlying the pathogenesis of CYVCV in lemon plants.

A prophage-encoded effector from "Candidatus Liberibacter asiaticus" targets ASCORBATE PEROXIDASE6 in citrus to facilitate bacterial infection.

Citrus huanglongbing (HLB), associated with the unculturable phloem-limited bacterium "Candidatus Liberibacter asiaticus" (CLas), is the most devastating disease in the citrus industry worldwide. However, the pathogenicity of CLas remains poorly understood. In this study, we show that AGH17488, a secreted protein encoded by the prophage region of the CLas genome, suppresses plant immunity via targeting the host ASCORBATE PEROXIDASE6 (APX6) protein in Nicotiana benthamiana and Citrus sinensis. The transient expression of AGH17488 reduced the chloroplast localization of APX6 and its enzyme activity, inhibited the accumulation of reactive oxygen species (H2 O2 and O2 - ) and the lipid oxidation endproduct malondialdehyde in plants, and promoted the proliferation of Pseudomonas syringae pv. tomato DC3000 and Xanthomonas citri subsp. citri. This study reveals a novel mechanism underlying how CLas uses a prophage-encoded effector, AGH17488, to target a reactive oxygen species accumulation-related gene, APX6, in the host to facilitate its infection.

First Report of citrus virus A infecting citrus (Citrus reticulata Blanco) in China.

Citrus is one of the most popular fruit crops in the world. Citrus virus A (CiVA, species Coguvirus eburi, genus Coguvirus) is a newly identified virus (Navarro et al. 2018) with two negative-sense single-stranded RNAs (RNA1 and RNA2). To date, CiVA has been detected on different citrus species in South Africa, U.S.A. and Greece (Bester et al. 2021; Park et al. 2021; Beris et al. 2021). CiVA has not been reported in China. In Sept. 2018, virus-like symptoms of leaf mottling, leaf flecking, and oak leaf patterns were observed on 'Orah' mandarin (Or) and 'Harumi' tangor (Ht) trees grown in Neijiang (NJ, Sichuan Province) and on Citrus reticulata cv.'Jinqiushatangju' (Jq) trees in Guizhou Province (GZ). Two mixed leaf samples (HY-NJ: 1 Or and 1 Ht and GZ-1: 2 Jq) were collected from symptomatic trees and then subjected to high-throughput sequencing (HTS). Total RNA was extracted by TRIzol. The cDNA library was constructed after depleting ribosomal RNA using a TruSeq RNA Sample Prep Kit and sequenced by Illumina HiSeq X-ten platform with paired-end reads length of 150 bp. After removing adaptors, low-quality reads, and reads homologous to citrus hosts by CLC Genomics Workbench 11 (Qiagen, U.S.A.), 917,547 and 1,508,134 clean reads were obtained from 56,239,772 and 81,535,900 total reads for HY-NJ and GZ-1, respectively. De novo assembly of the clean reads by CLC Genomics Workbench 11 resulted in 2,181 contigs for HY-NJ and 3,718 contigs for GZ-1. BLASTX searches of the contigs against local virus (taxid:10239) and viroid datasets (taxid:2559587) downloaded from NCBI allowed identification of several viruses and viroids. CiVA, citrus leaf blotch virus, citrus yellow vein clearing virus (CYVCV), and citrus psorosis virus (CPsV) were detected in HY-NJ. CiVA, hop stunt viroid, citrus viroid VI, citrus viroid V, citrus exocortis viroid, citrus dwarfing viroid, citrus bent leaf viroid, citrus bark cracking viroid, CYVCV, citrus tristeza virus, apple stem grooving virus, and CPsV were also detected in GZ-1. The lengths of the CiVA contigs were 6,682-nt and 6,670-nt matching RNA1 and 2,728-nt and 2,715-nt matching RNA2, respectively. The average coverage depth of clean reads mapped to CiVA-related contigs in HY-NJ was 64.90 and 156.54 for RNA1 and RNA2, respectively, and 26.50 and 558.08 in GZ-1. The full-length genomes of CiVA in HY-NJ and GZ-1 were determined by Sanger sequencing of six overlapping cDNA fragments obtained by RT-PCR and 5' and 3' RACE. At least 5 molecular clones were randomly selected for each fragment. The NJ isolate had a 6,690 nt RNA1 (GenBank accession no. MZ436805) and a 2,740 nt RNA2 (MZ436807). The GZ isolate had a 6,688 nt RNA1 (MZ436804) and a 2,734 nt RNA2 (MZ436806). BLASTN showed that the NJ and GZ isolates have 99.31 to 99.60% sequence identity to the isolate CG301 (MT922052; MT9220523). A phylogenetic tree constructed from nucleotide sequences indicated that the NJ and GZ isolates are closely related to the CG301 isolate. Among 105 citrus samples (35 Or and 30 Ht from NJ and 50 Jq from GZ) randomly collected, 11 samples (4 Or, 2 Ht and 5 Jq) with similar symptoms tested positive by RT-PCR using generic primers designed from conservative regions of RNA2 (F: TTGCAGTAGTGAGAAGGGAGT; R: TCAAAAGAGGCAGTGGTAGGA). To our knowledge, this is the first report of CiVA infecting citrus trees in China. The results will help facilitate further research to assess the threat of CiVA to citrus growing areas in China.

A "Candidatus Liberibacter asiaticus"-secreted polypeptide suppresses plant immune responses in Nicotiana benthamiana and Citrus sinensis.

Citrus Huanglongbing (HLB), known as the most economically devastating disease in citrus industry, is mainly caused by phloem-restricted Gram-negative bacterium "Candidatus Liberibacter asiaticus" (CLas). To date, CLas is still unculturable in vitro, which has been dramatically delaying the research on its pathogenesis, and only few Sec-dependent effectors (SDEs) have been identified to elucidate the pathogenesis of CLas. Here, we confirmed that a CLas-secreted Sec-dependent polypeptide, namely SECP8 (CLIBASIA_05330), localized in nucleus, cytoplasm and cytoplasmic membrane, and showed remarkably higher transcript abundance in citrus than in psyllids. Potato virus X (PVX)-mediated transient expression assays indicated that mSECP8 (the mature form of SECP8) suppressed pro-apoptotic mouse protein BAX and Phytophthora infestans elicitin INF1-triggered hypersensitive response (HR) associated phenotypes, including cell death, H2O2 accumulation and callose deposition. Intriguingly, mSECP8 also inhibited SDE1 (CLIBASIA_05315)-induced water-soaked and dwarfing symptoms in Nicotiana benthamiana. In addition, mSECP8 can promote the susceptibility of transgenic Wanjincheng orange (Citrus sinensis) to CLas invasion and further HLB symptom development, and it contributes to the proliferation of Xanthomonas citri subsp. citri (Xcc). Moreover, the expression of ten immunity-related genes were significantly down-regulated in mSECP8 transgenic citrus than those in wide-type (WT) plants. Overall, we propose that mSECP8 may serve as a novel broad-spectrum suppressor of plant immunity, and provide the first evidence counteractive effect among CLas effectors. This study will enrich and provide new evidences for elucidating the pathogenic mechanisms of CLas in citrus host.

A prophage-encoded nonclassical secretory protein of "Candidatus Liberibacter asiaticus" induces a strong immune response in Nicotiana benthamiana and citrus.

Huanglongbing (HLB), associated with "Candidatus Liberibacter asiaticus" (CLas), is a globally devastating plant disease. The highly reduced genome of CLas encodes a number of secretory proteins. The conserved prophage-encoded protein AGH17470 is herein identified as a nonclassical secretory protein. We confirmed that the N-terminal and C-terminal sequences jointly determine the secretion of AGH17470. The transient expression of AGH17470 protein in Nicotiana benthamiana caused hypersensitive response (HR) cell death in infiltrated leaves and systemically infected leaves as well as the dwarfing of the entire plant, suggesting that AGH17470 is involved in the plant immune response, growth, and development. Overexpression of AGH17470 in N. benthamiana and citrus plants up-regulated the transcription of pathogenesis-related and salicylic acid (SA)-signalling pathway genes and promoted SA accumulation. Furthermore, transient expression of AGH17470 enhanced the resistance of sweet orange to Xanthomonas citri subsp. citri. To our knowledge, AGH17470 is the first prophage-encoded secretory protein demonstrated to elicit an HR and induce a strong plant immune response. The findings have increased our understanding of prophage-encoded secretory protein genes, and the results provide clues as to the plant defence response against CLas.